#!/usr/bin/perl # PROGRAM : rev_and_trans.pl # PURPOSE : Simple driver for Bio::Seq revcom and translate # AUTHOR : Ewan Birney birney@sanger.ac.uk # CREATED : Tue Oct 27 1998 # # INSTALLATION # If you have installed bioperl using the standard # makefile system everything should be fine and # dandy. # # if not edit the use lib "...." line to point the directory # containing your Bioperl modules. # use Bio::Seq; use Bio::SeqIO; # new sequence from raw memory... # it is *very* important to get the type right so it # is translated correctly. $seq = Bio::Seq->new ( -id => "myseq", -seq => "CGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATGTCTAAGTCAGAGTCTCCT", -type => 'Dna'); $seqout = Bio::SeqIO->new('-format' => 'fasta', -fh => \*STDOUT); # make a reverse complement sequence $rev = $seq->revcom(); # the actual sequence is here $actual_bases = $rev->seq(); print "Reversed sequence as a string is [$actual_bases]\n"; # we could also write it as fasta formatted output $seqout->write_seq($rev); # make a translation $trans = $seq->translate(); print "Translated sequence!\n"; $seqout->write_seq($trans);