The EMBOSS Frequently Asked Questions list
==========================================
Last modified: 9 Jan 2003
SECTION A - Help and Support
============================
Q) How do I report bugs ?
A) mail emboss-bug@embnet.org
Q) Are there any mailing lists about EMBOSS?
A) emboss@embnet.org
is an open list (anyone can join) for general announcements and
discussions by end users.
emboss-dev@embnet.org
is a closed list for discussions by developers using EMBOSS.
To subscribe to either list, send mail to majordomo@embnet.org
with the message text subscribe emboss or subscribe emboss-dev
Q) Where's the documentation?
A) All the documentation can be found at the following web page
http://www.uk.embnet.org/Software/EMBOSS/
Q) Where's the applications' documentation?
A) http://www.uk.embnet.org/Software/EMBOSS/Apps/
Q) Is there a tutorial?
A) Short tutorial:
http://www.hgmp.mrc.ac.uk/Registered/Help/emboss/short_emboss_tutorial/
Long tutorial:
http://www.hgmp.mrc.ac.uk/Registered/Help/emboss/
Q) Is there a quick guide?
A) A revised version is now available incorporating many of the suggestions
I have had. In order to get everything on I have shrunk the text to 9pt
(sorry, no free magnifying glasses) and also prepared a postscript
version.
ftp://ftp.no.embnet.org/embnet/tutorials/EMBOSS_QG.ps (Postscript file)
ftp://ftp.no.embnet.org/embnet/tutorials/EMBOSS_QG.doc (Word 97 format- Yuk!)
Q) Is there a table of substitutes for GCG programs?
A) http://www.no.embnet.org/FromGCG.html
Q) Is there a reference I can cite for EMBOSS?
A) Rice,P. Longden,I. and Bleasby,A.
"EMBOSS: The European Molecular Biology Open Software Suite"
Trends in Genetics June 2000, vol 16, No 6. pp.276-277
SECTION B - Installation & Compilation
======================================
Q) EMBOSS won't compile properly
A) Make sure you have the latest code and if you have compiled before
try the following:-
rm config.cache
make clean
./configure
make
If this is the first time trying to compile all you need to do is:-
./configure
make
Q) I'm trying to compile EMBOSS with the PNG support
A) If you have gd-1.7.3, zlib-1.1.3 and libpng-1.0.5 or greater
then the normal compile should work! However due to gd no longer
supporting gif format then you may need to install gd, zlib and
libpng locally.
You can unpack the tar.gz files in any directory, and install them in
a common area.
By default everything (including EMBOSS) installs
in /usr/local but in the examples below we use /home/joe/local
Note: gd does not use a ./configure script, and will fail at the
"make install" stage if the installation directory does not have a
/bin subdirectory. You can create this directory
(e.g. /home/joe/local/bin) if it does not already exist.
To install, pick up the sources (jpeg is optional) and then:
gunzip -c zlib-1.1.4.tar.gz | tar xf -
gunzip -c libpng-1.2.5.tar.gz | tar xf -
gunzip -c jpegsrc.v6b.tar.gz | tar xf -
gunzip -c gd-2.0.9.tar.gz | tar xf -
ln -s zlib-1.1.4 zlib
ln -s jpeg-6b jpeg
ln -s libpng-1.2.5 libpng
ln -s gd-2.0.9 gd
If these directories do not exist, "make install" for jpeg will need them:
mkdir /home/joe/local/bin
mkdir /home/joe/local/man
mkdir /home/joe/local/man1
cd zlib
./configure --prefix=/home/joe/local
make
make install
cd ..
cd jpeg
./configure --prefix=/home/joe/local
make
make test
make install
cd ..
cd libpng
./configure --prefix=/home/joe/local
But this says:
There is no "configure" script for Libpng-1.2.5. Instead, please
copy the appropriate makefile for your system from the "scripts"
directory. Read the INSTALL file for more details.
so copy the file, for example "cp scripts/makefile.linux makefile"
##
## edit makefile, change prefix to be /home/joe/local
## and any other places - some files point to ../zlib
## others use /usr/local/lib and /usr/local/include
##
## on HP-UX this is trickier. CFLAGS has to match zlib
##
make
make install
cd ..
cd gd
##
## for 1.x versions, edit Makefile, change:
## INCLUDEDIRS, LIBDIRS, INSTALL_LIB, INSTALL_INCLUDE, INSTALL_BIN
## all /usr/local
## to /home/joe/local
##
## for 2.x versions, we use ./configure (hurrah!)
./configure --prefix=/home/joe/local --with-png=/home/joe/local \
--with-jpeg=/home/joe/local
make
make install
cd ..
If the gd or jpeg "make install" fails with a warning about the "bin"
"man" or "man/man1" directory, you need to create it by hand (see above).
To compile with the local version your EMBOSS ./configure line should now
read:-
./configure --with-pngdriver=/home/joe/local
This will look for the graphics libraries in your local
installation under /home/joe/local instead of a system-wide location
configure keeps a copy of the previous settings. You may need to delete
file config.cache and config.status if configure has been run before.
Q) When installing EMBOSS recently I get a load of errors due to
libraries not found. The main problem is that I have an old version of
libz but no lib gd in my system libraries and EMBOSS looks there first
to try to locate these libraries. I have the correct versions installed
elsewhere.
Deleting -lgd -lz -lpng from CFLAGS in the ajax directory Makefile works
but is an ugly solution and not really ideal.
Are there any suggestions for setting the library search path or am I
missing something really obvious?
A) There are the
--without-pngdriver
and
--with-pngdriver=dir
flags. Did you try them? If the libraries are in /opt/png/lib then
set "dir" to /opt/png i.e. one level above the "lib" directory.
Q) Can I get the latest code via CVS ?
A) Yes. Here is the information you will need:-
Make sure you have cvs on your system Then log into the cvs server at
'open-bio.org' as: user 'cvs' with password 'cvs'.
cvs -d :pserver:cvs@cvs.open-bio.org:/home/repository/emboss login
The password is 'cvs'
To checkout the EMBOSS source code tree, put yourself in a local directory
just above where you want to see the EMBOSS directory created. For example
if you wanted EMBOSS to be seen as /home/joe/src/emboss... then cd into
/home/joe/src then checkout the repository by typing:
cvs -d :pserver:cvs@cvs.open-bio.org:/home/repository/emboss checkout emboss
Or if you want to update a previously checked-out source code tree:
cvs -d :pserver:cvs@cvs.open-bio.org:/home/repository/emboss update
You can logout from the CVS server with:
cvs -d :pserver:cvs@cvs.open-bio.org:/home/repository/emboss logout
(this is a read only server).
Q) How do i compile the CVS version?
A) You will need automake, autoconf, gmake and libtool for this.
The gcc compiler is recommended. The host cc compiler should work,
but there is a problem with automake which generates the Makefiles.
automake generates dependencies for you, in a '.deps' subdirectory,
to keep Makefile.in clean, but since automake 1.4 this uses gcc. If
you are not using gcc, you can use 'automake --include-deps' to
put the dependencies into each Makefile.in file
Scripts are available to compile the cvs version.
i.e. source make-static-developers
will compile a statically linked EMBOSS.
What this actually does is:-
aclocal -I m4
autoconf
automake -a # --include-deps # if you are not using gcc
./configure --disable-shared
make
For more info on the configurability of the build try
./configure --help
Q) Installing associated software MSE.
A) a) from the anonymous cvs code.
1) Go to the mse directory
cd embassy/mse
2) make the configuration file
aclocal
autoconf
automake
3) configure and compile
./configure (use same options as you used to compile emboss)
make
make install
b) from MSE-0.0.4.tar.gz
available from our FTP server ftp://ftp.uk.embnet.org/pub/EMBOSS/
in file MSE-0.0.4.tar.gz
1) Go to the emboss directory
cd EMBOSS-0.0.4
2) make new directory embassy if it does not exist already.
mkdir embassy
3) Go into that directory
cd embassy
4) unzip and untar the file
gunzip MSE-0.0.4.tar.gz
tar xvf MSE-0.0.4.tar
5) go into the mse directory
cd MSE-0.0.4
6) configure and compile
./configure (use same options as you used to compile emboss)
make
make install
Q) Installing associated software PHYLIP
A) a) from the anonymous cvs code.
1) Go to the phylip directory
cd embassy/phylip
2) make the configuration file
aclocal
autoconf
automake
3) configure and compile
./configure (use same options as you used to compile emboss)
make
make install
b) from PHYLIP-3.573c.tar.gz
available from our FTP server ftp://ftp.uk.embnet.org/pub/EMBOSS/
in file PHYLIP-3.573c.tar.gz
1) Go to the emboss directory
cd EMBOSS-0.0.4
2) make new directory embassy if it does not exist already.
mkdir embassy
3) Go into that directory
cd embassy
4) unzip and untar the file
gunzip PHYLIP-3.573c.tar.gz
tar xvf PHYLIP-3.573c.tar
5) go into the phylip directory
cd PHYLIP-3.573c
6) configure and compile
./configure (use same options as you used to compile emboss)
make
make install
Q) Problems finding PHYLIP acd files ?
A) The 1.0 release of EMBOSS should be able to find the acd files
in the install directory or in the original source directory.
If you have copied the phylip binaries to another location and
removed these files you can still point to the new ACD directory.
If you have installed PHYLIP to the same top directory as EMBOSS
i.e. by default this is usually /usr/local/ (via make install)
then if you set the following in your .embossrc file then your
PHYLIP acd files will be found in
/usr/local/share/EMBOSS/acd/
if you have not installed PHYLIP then you will can set
emboss_acdroot to the directory containing the acd files or
copy them to the emboss/acd directory.
To tell EMBOSS where to find the files, specify the full path
of the ACD directory in your ~/.embossrc file, or in the
emboss.default file.
env emboss_acdroot /usr/local/share/EMBOSS/acd/
Q) What benefits do i gain from using the associated versions of
software.
A) a) You can read any sequence type that emboss can handle.
b) the associated software will use the emboss acd files so the
naming of output/input files is taken care of and will check all
values before the program is run. Command line arguments are used
instead interactive menu based ones.
Q) I have Emboss installed on our development server and I'm preparing a
dispatch which will send it out to about 20 remote sites.
I ran the configure with the --prefix option to install to a private
directory. I also collected all the data files (rebase, transfac etc.) to
another directory and extracted the information from them with the relevant
programs.
My intention was to simply transfer the Emboss install directory and the
Data directory to all sites, using symlinks where necessary so that the
directory paths corresponded.
However, when testing this I have found a couple of problems;
1) Although the Emboss programs work, I can't see any of the extracted data.
For instance remap gives the error;
EMBOSS An error in remap.c at line 167:
Cannot locate enzyme file. Run REBASEEXTRACT
This is despite the fact that I have both the Emboss install and the Data
directories in the same place as on the development machine (which works).
2) The other major problem is that I can no longer see my databases defined
in emboss.default. Again, the file exists, and is in the same place as on
the development machine, but the box it is transferred to gives an empty
list from showdb.
Does anyone know where Emboss stores the information about the location of
these files? It can't have installed anything outside the original
installation directory (wasn't installed as root), so I'm guessing that the
problem stems from the program resolving symlinks at some point.
A) It is inside the binaries ...
EMBOSS 'knows' the location of the files because it is picked up during the
configure, when you build your copy, and included in the binaries.
You can see it during compilation, especially of ajnam.c (where it is used):
-DAJAX_FIXED_ROOT=\"/full/source/path\" -DPREFIX=\"/install/prefix/path\"
To copy binaries, you need to define environment variable(s) to
override the compile-time definitions, unless you can make the path
(e.g. /usr/local) the same for the installations at each site.
emboss.default can set environment variables too, but you need to tell
EMBOSS where to find that file.
setenv EMBOSS_ROOT /dir/for/default/file
and then, in the emboss.default file you can set:
SET EMBOSS_ACDROOT /install/dir/share/EMBOSS/acd
or (this overrides it) you can use another environment variable:
SET EMBOSS_ACDROOT /install/dir/share/EMBOSS/acd
(Peter Rice 22 Nov 2000)
Q) I have downloaded the Emboss source and installed it for use at XYZ
University without any difficulty. The administration guide has advice
on configuring the software using emboss.default, and has examples for
allowing access to SRS indices. That appears to be done via the program
getz, which is not part of the Emboss package.
A) If you have SRS installed (so you have local SRS index files) you will
have a local copy of the getz program, which is part of SRS.
If you do not have SRS, you can build your own index files using dbiflat,
dbigcg (if you have GCG), dbiblast (if you have blast) and dbifasta. This is
the usual solution for sites that have no other database indexing in use.
You can also use SRS servers remotely, to get single entries, using their
URLs. No extra software is needed (EMBOSS just uses the HTTP protocol).
Of course, if you really need to build your own SRS indices you
could install it. SRS is a commercial product, but academic licences are
available. But as I now work for the developers of SRS, and this is
the EMBOSS bug mailing list, I shall say no more :-)
(Peter Rice 9 Jan 2001)
Q) I am not getting full static files even when I configure with
--disable-shared
A) This most often happens when using GNU LD. If both shared and
static versions of a library exist then GNU LD will take the
shared library as preferred. The root of this problem is libtool.
You can, however, force complete static images by adding a
definition to your "make" line:
make "LDFLAGS=-Wl,-static"
(Alan Bleasby 14 Feb 2001)
Q) Has anybody compiled and set up the EMBOSS package under Mac OS-X ?
A) This is how I was able to build EMBOSS on MacOSX.
I tested EMBOSS-1.0.1.tar.gz release of last fall
STEP 0
if not done, install MacOSX developer CD package
STEP 1
-- as root make cc compiler known as gcc (which it is)
-- (this will make your life simpler installing gnu-based packages)
cd /usr/bin
ln cc gcc
STEP 2
-- unpack EMBOSS-*.tar.gz somewhere
gnutar -zxf EMBOSS-1.0.1.tar.gz
cd EMBOSS-1.0.0
STEP 3
-- edit configure file to fix some things
-- configure -> ltconfig has problem with passing $host value
-- remove -lX11 as constant (so --without-x works)
# fix ltconfig call so host is specified (some configure bug)
<< find
$libtool_flags --no-verify $ac_aux_dir/ltmain.sh $host \
>> change to
$libtool_flags --no-verify $ac_aux_dir/ltmain.sh darwin \
<< find
if test "$no_x" = yes; then
# Not all programs may use this symbol, but it does not hurt to define it.
cat >> confdefs.h <<\EOF
#define X_DISPLAY_MISSING 1
EOF
X_CFLAGS= X_PRE_LIBS= X_LIBS= X_EXTRA_LIBS=
else
>> add this X_LIBS=-lX11 line
X_LIBS=-lX11
if test -n "$x_includes"; then
X_CFLAGS="$X_CFLAGS -I$x_includes"
fi
<< find
XLIB="$X_LIBS -lX11 $X_EXTRA_LIBS"
>> change to
XLIB="$X_LIBS $X_EXTRA_LIBS"
STEP 4
-- configure and make. after above edits, the make worked
./configure --host=darwin --without-x
make >& log.make &
STEP 5
-- test some things
emboss/getorf test/data/dna.genbank -outseq stdout
emboss/pepstats test/data/prot.swiss -outfile stdout
-- try a graphic one
setenv PLPLOT_LIB `pwd`/plplot/lib
emboss/plotorf -graph ps test/embl/rod.dat
-- install in default /usr/local/... as root
make install
Notes:
-- you will need to fetch and install some standard data
to use several programs (see emboss/data/)
-- w/o an X Window server, default graphics won't show up.
Tenon(?) sells an Xwindow server for MacOSX
(Don Gilbert gilbertd@bio.indiana.edu 14 May 2001)
SECTION C - Graphics
====================
Q) What Graphics options are available?
A) To see what graphics drivers are available type ? at the promt for
the graph type and this will give you a list.
Here are some of those:-
ps -> Postscript
cps -> Colour Postscript
x11 -> X display. (also called xterm and xwindows)
hpgl -> HP Laserjet III, HPGL emulation mode.
png -> PNG (you will need png, z and gd libraries for this)
tek -> Tektronix Terminal
none -> None.
data -> Writes out points to a file for graphs.
meta -> plplot meta file.
Q) How do i get the PNG driver?
A) To get the PNG driver you will need to have installed z,png and gd
libraries. In particular gd version >= 1.7.3 must be used.
If for some reason you do not have the required libraries and your
system support group will not update these ( In particular gd, as
the older versions support GIF which is NOT supported in later
versions) then install all three latest versions (z,gd,png) to a
new directory and then add this new directory to your configure
line for EMBOSS.
i.e.
make clean
rm config.cache
./configure --with-pngdriver=/home/joe/new
as i installed gd etc using --prefix=/home/joe/new
in the configure of each.
If you have recently installed the libraries to your system then
make clean
rm config.cache
./configure
By removing config.cache you are telling the system to check
again for what is available as these are stored in that file.
make clean removes all the current objects and EMBOSS libraries
as these will now need to include the png driver code.
Q) Where to look for the additional libraries needed for PNG.
A)
GD) http://www.boutell.com/gd/
Z) http://www.mirror.ac.uk/sites/ftp.cdrom.com/pub/infozip/zlib/
JPEG) http://www.ijg.org/
PNG) http://www.mirror.ac.uk/sites/ftp.libpng.org/pub/png/libpng.html
These also list the various mirror sites for non UK people.
Alternatively, using ftp :-
GD) (boutell.com no longer allows FTP, no known mirror sites, use HTTP)
Z) ftp://ftp.info-zip.org/pub/infozip/zlib/zlib-1.1.3.tar.gz
JPEG) ftp://ftp.uu.net/graphics/jpeg/
PNG) ftp://swrinde.nde.swri.edu/pub/png/src/libpng.1.2.1.tar.gz
Q) Plotters and pen colours.
A) The hp drivers presume the pens are loaded as:-
SP1 black
SP2 white
SP3 red
SP4 green
SP5 blue
SP6 cyan
SP7 magenta
SP8 yellow
Otherwise your output will have different colours.
Q) Browsing the Gnu site I came across libplot, libxmi and plot utils.
Would these be a suitable replacement for PLPLOT?
A) So far they are still GPL rather than LGPL.
Robert Maier promised a while back to LGPL them but has not yet. Pity.
Makes all the difference for linking in third party applications to
EMBOSS.
Q) I am trying to compile PNG support into EMBOSS on our CTU Unix system. This
requires the z, png and gd libraries, which are not on our system at the
moment.
Does anyone know where I can get these libraries for either OSF or CTU Unix?
All the references to them I have found on the web have been for Linux. Are
these platform independent (so I can use the Linux libraries)? Or do I need
specific versions for our unix version?
A) You should be able to compile them from the source on just about any
Unix platform.
http://www.info-zip.org/pub/infozip/zlib/
http://libpng.sourceforge.net/
http://www.boutell.com/gd/
Q) I get error messages when I try to display X11 on my PC.
I am running the Hummingbird Exceed X11 emulator.
A) The Hummingbird Exceed X11 emulator (and maybe other systems) use the
'TrueColor' display by default.
You should change the configuration settings so that it uses 'PseudoColor'.
In version 6.1 of Hummingbird Exceed, this is done by clicking on the
Exceed section of the Windows 98 tool bar at the bottom of the screen.
Select 'Tools', then 'Configuration', then Screen Definition.
A window will appear.
In the 'Server Visual' popup menu on the left, select 'PseudoColor'.
Click on 'OK'.
SECTION D - Data Files
======================
Q) How do I use my own private data file?
A) You may wish to amend one of the standard EMBOSS data files. One of
the data files you might wish to alter are the translation table files.
'transeq' has been written to only read in one of the standard
translation files:
EGC.0
EGC.1
EGC.2
EGC.3
EGC.4
EGC.5
EGC.6
EGC.9
EGC.10
EGC.12
EGC.11
EGC.13
EGC.14
EGC.15
These files are the only ones that you can specify to 'transeq'.
If you wish to create your own specialised translation table, then you
should pick one of them to amend.
For instance you may decide that you will use the file EGC.15 as you
would never want to use this otherwise.
Use the program 'embossdata' to get a copy of this file:
% embossdata -fetch -filename EGC.15
Finds or fetches the data files read in by the EMBOSS programs
File '/packages/emboss/emboss/data/EGC.15' has been copied successfully.
Edit the file EGC.15 to suit your requirements.
Specify '-table 15' when you run 'transeq' to use this altered file.
'transeq' will then look for the file 'EGC.15' and will find it in your
current directory before it finds the default one in the EMBOSS_DATA
directory. It will therefore use your local copy.
You may get confused with many copies of changed files floating about.
To check which copy of a file is being used - the default EMBOSS_DATA
one or a potential local copy, use 'embossdata':
% embossdata -filename EGC.15
Finds or fetches the data files read in by the EMBOSS programs
# The following directories can contain EMBOSS data files.
# They are searched in the following order until the file is found.
# If the directory does not exist, then this is noted below.
# '.' is the UNIX name for your current working directory.
File ./EGC.15 Exists
File .embossdata/EGC.15 Does not exist
File /people/gwilliam/EGC.15 Does not exist
File /people/gwilliam/.embossdata/EGC.15 Does not exist
File /packages/emboss/emboss/data/EGC.15 Exists
This shows that a copy of EGC.15 exists in your current directory and so
will be used in preference to the default one in the EMBOSS_DATA
directory.
SECTION E - Sequence Files and Formats
======================================
Q) How do you write sequences to different files instead of writing them
all to one file?
A) EMBOSS is not good at writing multiple sequences to different files.
You could try using 'nthseq' to pull out one sequence at a time.
You should consider using the '-ossingle' qualifier. This writes
sequences to separate FASTA files, but the file names depend on the
sequence ID. This is rarely used. It is there because -ossingle is the
default for GCG output format. The output filename is currently ignored
when ossingle is used, and the filename depends on each individual
sequence.
Q) What sequence formats are supported?
A) Many:
gcg, embl, swissprot, fasta, ncbi, genbank, nbrf, codata, strider,
clustal, phylip, acedb, msf, ig, staden, text, raw, asis
Q) What is the difference between TEXT and RAW formats?
A) TEXT accepts everything in the sequence file as sequence.
RAW accepts only alphanumeric and whitespace characters and rejects
anything else.
Q) What is ASIS format?
A) The "filename" is really the sequence.
This is a quick and easy way of reading in a short fragment of
sequence without having to enter it into a file.
For example:
% program -seq asis::ATGGTGAGGAGAGTTGTGATGAGA
Q) I have some very short protein sequences that EMBOSS thinks are
nucleic sequences. How do I force EMBOSS to treat them as nucleic acid
sequences?
For example:
> cat seq1
A
> cat seq2
I
% water seq1 seq2 -stdout -auto
Smith-Waterman local alignment.
An error has been found: Sequence is not nucleic
Here, 'water' automatically (and wrongly) thinks that A is adenosine
instead of alanine and fails when it reads in seq2 and expects to
find another nucleic acid sequence - but 'I' is not a valid base and
so it fails.
A) For many sequence formats there is no way to specify the sequence
type in the file, so EMBOSS has to guess.
There is a flag that can force EMBOSS programs to treat sequences as
nucleic or protein.
'water -help -verbose'
shows the full list of sequence qualifiers.
If you follow the sequence USA with '-sprotein' EMBOSS will check
that it is a valid protein sequence.
If you need to force a sequence to be DNA, the qualifier is
'-snucleotide'
The qualifier must follow the sequence to apply to one sequence, or
can go at the start of the command line to refer to all sequences, for
example:
'water -sprotein seq4 seq3 -stdout -auto'
You can also use '-sprotein1' anywhere on the command line to refer
to the first sequence and '-sprotein2' to refer to the second sequence.
Of course, like all EMBOSS qualifiers, you can shorten them so long
as they are still unique. In this case, '-sp' and '-sn' will work
(or '-sp1' and '-sp2' if you need the numbers).
SECTION F - Limits and contraints
=================================
Q) Is there a maximum size for sequences?
A) The maximum size for any program depends only on how much memory your
system has.
Of course, some programs (and some program options) can take up too
much memory, or simply run very slowly.
You might have a constraint imposed on your usage of memory.
Try using the Unix command 'limit' to look at such constraints.
Try using the Unix command 'unlimit' to remove the constraints, eg:
% unlimit stacksize
% unlimit vmemoryuse
Q) GCG has a somewhat arbitrary fragment length limit of 2500 bp for gel*.
Is there a similar limit for MSE under EMBOSS?
A) No. MSE has no limit, you are only limited by how much memory you
have.
SECTION G - Running under Web servers and from scripts
======================================================
Q) I am trying to write a web interface for an emboss program
and run apache. The program complains that there is no HOME
directory set.
A) Just put these at the top after your 'use CGI' ( whatever) statements.
$ENV{HOME}=<web owner root> i.e. /usr/local/apache
$ENV{EMBOSS_DATA}=<emboss data directory>
These two are important, but you can also pass other "constants".
SECTION H - Programs and options
================================
Q) Plotting with pepwheel gives interesting output.
pepwheel -turns=8 -send=30 sw:p77837 -auto
gives a helical wheel plot but the residues are plotted so every two
circles are sat on top of one another.
A) That is the correct answer.
Instead of 3.6 residues per turn, (5 turns in 18 steps) you seem to
have a helix with 8 turns in 18 steps (4 in 9).
Try -turns=4 -steps=9 ... but only if you are sure that is the
way your helix goes.
I suppose we could play with checking for common factors in pepwheel,
but I don't know of any biologically meaningful setting that would
cause problems.
Q) In prettyplot, How do you specify an output file name for the plot file?
A) prettyplot -auto ~/wordtest/globin-nogap.msf -graph ps
Creates prettyplot.ps
The name is generated automatically. To set this to something more
discriptive use -go .i.e
prettyplot -auto ~/wordtest/globin-nogap.msf -graph ps -go=hello
Creates hello.ps
Q) In the editor 'mse', but I don't know how to save my edited sequences
at the end of the editing session.
A) Use Control-Z to get into command mode.
Then use the SAVE command which will prompt for the file name.
Q) I would like to know if EMBOSS can perform nucleotide contig assembly
similar to the function that GCG gelproject/gelview has. And if yes, is
there any size restriction on the number of basepair and the number of
contigs? thank you.
A) EMBOSS does not cover the sort of contig assembly you describe. We
leave that as the province of the Staden package from the LMB in
Cambridge (down the road). Rodger Stadens group is developing a GUI
(Spin) which uses both EMBOSS and his gel assembly programs.
(29 Jan 2001)
